Journal of Alzheimer's Disease - Volume 93, issue 1

Authors: Fillenbaum, Gerda G. | Mohs, Richard

Article Type: Review Article

Abstract: Background: In 1986, the Consortium to Establish a Registry for Alzheimer’s Disease (CERAD) was mandated to develop a brief neuropsychological assessment battery (CERAD-NAB) for AD, for uniform neuropsychological assessment, and information aggregation. Initially used across the National Institutes of Aging-funded Alzheimer’s Disease Research Centers, it has become widely adopted wherever information is desired on cognitive status and change therein, particularly in older populations. Objective: Our purpose is to provide information on the multiple uses of the CERAD-NAB since its inception, and possible further developments. Methods: Since searching on “CERAD neuropsychological assessment battery” or similar terms missed …important information, “CERAD” alone was entered into PubMed and SCOPUS, and CERAD-NAB use identified from the resulting studies. Use was sorted into major categories, e.g., psychometric information, norms, dementia/differential dementia diagnosis, epidemiology, intervention evaluation, genetics, etc., also translations, country of use, and alternative data gathering approaches. Results: CERAD-NAB is available in ∼20 languages. In addition to its initial purpose assessing AD severity, CERAD-NAB can identify mild cognitive impairment, facilitate differential dementia diagnosis, determine cognitive effects of naturally occurring and experimental interventions (e.g., air pollution, selenium in soil, exercise), has helped to clarify cognition/brain physiology-neuroanatomy, and assess cognitive status in dementia-risk conditions. Surveys of primary and tertiary care patients, and of population-based samples in multiple countries have provided information on prevalent and incident dementia, and cross-sectional and longitudinal norms for ages 35–100 years. Conclusion: CERAD-NAB has fulfilled its original mandate, while its uses have expanded, keeping up with advances in the area of dementia. Show more

Keywords: Alzheimer’s disease, CERAD, CERAD Plus, Consortium to Establish a Registry for Alzheimer’s Disease, epidemiological surveys, incidence, neuropsychological assessment, norms, prevalence

DOI: 10.3233/JAD-230026

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 1-27, 2023

Authors: Hendrie, Hugh C.

Article Type: Article Commentary

Abstract: The 1980s saw an upsurge of research in Alzheimer’s disease (AD). The necessity of standardized assessment batteries became apparent, leading to the development of standardized instruments, such as the CERAD, the CAMDEX, the CSI ’D’, and later the TOOLBOX. The advent of new biological markers has led to speculation in the research community about the necessity for these instruments. As the association of biomarkers with subsequent clinical dementia remains unclear, assessment batteries are still necessary, especially with growing evidence that prodromal symptoms of AD may not be cognitive decline but emotional or behavioral symptoms. Inclusion of ethnic minority groups is …also essential. Show more

Keywords: Alzheimer’s disease, biological markers, ethnic minority representation, standardized assessment tools

DOI: 10.3233/JAD-230215

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 29-32, 2023

Authors: Hook, Gregory | Kindy, Mark | Hook, Vivian

Article Type: Review Article

Abstract: The lysosomal cysteine protease cathepsin B (CTSB) has been suggested as a biomarker for Alzheimer’s disease (AD) because elevated serum CTSB in AD patients has been found to correlate with cognitive dysfunction. Furthermore, CTSB gene knockout (KO) in non-transgenic and transgenic AD animal models showed that elimination of CTSB improved memory deficits. However, conflicting CTSB KO results on amyloid-β (Aβ) pathology in transgenic AD models have been reported. The conflict is resolved here as likely being due to the different hAβPP transgenes used in the different AD mouse models. CTSB gene KO reduced wild-type (Wt) β-secretase activity, brain …Aβ, pyroglutamate-Aβ, amyloid plaque, and memory deficits in models that used cDNA transgenes expressing hAβPP isoform 695. But in models that used mutated mini transgenes expressing hAβPP isoforms 751 and 770, CTSB KO had no effect on Wt β-secretase activity and slightly increased brain Aβ. All models expressed the AβPP transgenes in neurons. These conflicting results in Wt β-secretase activity models can be explained by hAβPP isoform specific cellular expression, proteolysis, and subcellular processing. CTSB KO had no effect on Swedish mutant (Swe) β-secretase activity in hAβPP695 and hAβPP751/770 models. Different proteolytic sensitivities for hAβPP with Wt versus Swe β-secretase site sequences may explain the different CTSB β-secretase effects in hAβPP695 models. But since the vast majority of sporadic AD patients have Wt β-secretase activity, the CTSB effects on Swe β-secretase activity are of little importance to the general AD population. As neurons naturally produce and process hAβPP isoform 695 and not the 751 and 770 isoforms, only the hAβPP695 Wt models mimic the natural neuronal hAβPP processing and Aβ production occurring in most AD patients. Significantly, these CTSB KO findings in the hAβPP695 Wt models demonstrate that CTSB participates in memory deficits and production of pyroglutamate-Aβ (pyroglu-Aβ), which provide rationale for future investigation of CTSB inhibitors in AD therapeutics development. Show more

Keywords: Alzheimer’s disease, amyloid-β, AβPP isoform, β-secretase, cathepsin B, cDNA, gene, memory deficits, mouse models, neuron, promoter

DOI: 10.3233/JAD-221005

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 33-46, 2023

Authors: Umfleet, Laura Glass | Bilder, Robert M. | Loring, David W. | Thames, April | Hampstead, Benjamin M. | Bauer, Russell M. | Drane, Daniel L. | Cavanagh, Lucia

Article Type: Review Article

Abstract: Cognitive screening instruments (CSI) have variable sensitivity and specificity to the cognitive changes associated with dementia syndromes, and the most recent systematic review found insufficient evidence to support the benefit of cognitive screening tools in older adults residing within the community. Consequently, there is a critical need to improve CSI methods, which have not yet incorporated advances in psychometrics, neuroscience, and technology. The primary goal of this article is to provide a framework for transitioning from legacy CSIs to advanced dementia screening measurement. In line with ongoing efforts in neuropsychology and the call for next-generation digital assessment for early detection …of AD, we propose a psychometrically advanced (including application of item response theory methods), automated selective assessment model that provides a framework to help propel an assessment revolution. Further, we present a three-phase model for modernizing CSIs and discuss critical diversity and inclusion issues, current challenges in differentiating normal from pathological aging, and ethical considerations. Show more

Keywords: Alzheimer’s disease, cognitivescreening instruments, dementia, neuropsychology

DOI: 10.3233/JAD-221077

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 47-59, 2023

Authors: Weidung, Bodil | Lövheim, Hugo | Littbrand, Håkan | Wahlin, Johanna | Olofsson, Birgitta | Gustafson, Yngve

Article Type: Research Article

Abstract: Background: Long-increasing dementia incidence and prevalence trends may be shifting. Whether such shifts have reached the very old is unknown. Objective: To investigate temporal trends in the incidence of dementia and cognitive impairment and prevalence of dementia, cognitive impairment, Alzheimer’s disease, vascular dementia, and unclassified dementia among 85-, 90-, and ≥ 95-year-olds in Sweden during 2000–2017. Methods: This study was conducted with Umeå 85 + /Gerontological Regional Database data from 2182 85-, 90-, and ≥ 95-year-olds in Sweden collected in 2000–2017. Using logistic regression, trends in the cumulative 5-year incidences of dementia and cognitive impairment; prevalences of dementia, …cognitive impairment, Alzheimer’s disease, and vascular dementia; and Mini-Mental State Examination thresholds for dementia diagnosis were estimated. Results: Dementia and cognitive impairment incidences decreased in younger groups, which generally showed more-positive temporal trends. The prevalences of overall dementia, cognitive impairment, and Alzheimer’s disease were stable or increasing; longer disease durations and increasing dementia subtype classification success may mask positive changes in incidences. Vascular dementia increased while unclassified dementia generally decreased. Conclusion: The cognitive health of the very old may be changing in the 21st century, possibly indicating a trend break. Show more

Keywords: Aged 80 and over, Alzheimer’s disease, cognition disorders, cohort studies, cross-sectional studies, dementia, epidemiologic studies, longitudinal studies, neurocognitive disorders, vascular dementia

DOI: 10.3233/JAD-220915

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 61-74, 2023

Authors: Grisanti, Stefano Giuseppe | Massa, Federico | Chincarini, Andrea | Pretta, Stefano | Rissotto, Roberto | Serrati, Carlo | Monacelli, Fiammetta | Serafini, Gianluca | Calcagno, Pietro | Brugnolo, Andrea | Pardini, Matteo | Nobili, Flavio | Girtler, Nicola | Schenone, Angelo | Nencioni, Alessio | Amore, Mario | Biffa, Gabriella | Sambuceti, Gianmario | Morbelli, Silvia | Roccatagliata, Luca | Castellan, Lucio | Travalca, Cupillo Beatrice | Castellini, Paola | Fiocca, Roberto | Gaggero, Gabriele | Mandich, Paola | Origone, Paola | Livrari, Barbara

Article Type: Research Article

Abstract: Background: Apathy is a frequent behavioral symptom of Alzheimer’s disease (AD). The Apathy Evaluation Scale (AES) is a tool exploring the perception of apathy by both caregivers (CG-AES) and patients (PT-AES), and the discrepancy in their ratings is a proxy of patients’ disease unawareness. Objective: To assess in a cohort study of patients with amnesic mild cognitive impairment (aMCI) whether apathy and awareness of apathy predict progression to dementia and timing. Methods: From the global AES scores of 110 patients with aMCI and their caregivers, we obtained two principal indices for analysis: 1) ‘Apathy’, the mean …of PT-AES and CG-AES, and 2) ‘Discrepancy’, obtained by subtracting CG-AES from PT-AES. Patients were followed with visits every six months for three years or until dementia. AES indices and the principal demographical/neuropsychological variables were filtered from multicollinearity. The most robust variables entered a logistic regression model and survival analyses (Cox regression, log-rank test of Kaplan-Meier curves) to estimate which predicted the risk and timing of progression, respectively. Results: Sixty patients (54.5%) developed dementia (57 AD) after 6.0–36.0 months, 22 (20%) remained in an MCI stage, and 28 (25.5%) dropped out. ‘Discrepancy’ was a robust and accurate predictor of the risk of progression (AUC = 0.73) and, after binarization according to a computed cutoff, of timing to dementia. Conclusion: A structured evaluation of apathy, both self-assessed and estimated by caregivers, can provide useful information on the risk and timing of progression from aMCI to dementia. The discrepancy between the two estimates is a fairly reliable index for prediction purposes as a proxy of disease unawareness. Show more

Keywords: Alzheimer’s disease, apathy, awareness, dementia discrepancy, mild cognitive impairment

DOI: 10.3233/JAD-220418

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 75-86, 2023

Authors: Moon, Seok Woo | Byun, Min Soo | Yi, Dahyun | Kim, Min Jung | Jung, Joon Hyung | Kong, Nayeong | Jung, Gijung | Ahn, Hyejin | Lee, Jun-Young | Kang, Koung Mi | Sohn, Chul-Ho | Kim, Yu Kyeong | Lee, Dong Young

Article Type: Research Article

Abstract: Background: Ankle-brachial index (ABI), an indicator of atherosclerosis or arterial stiffness, has been associated with Alzheimer’s disease (AD) dementia and related cognitive impairment. Nevertheless, only limited information is available regarding its contribution to brain alterations leading to cognitive decline in late-life. Objective: We aimed to investigate the relationship of ABI with in vivo AD pathologies and cerebrovascular injury in cognitively impaired older adults. Methods: Total 127 cognitively impaired (70 mild cognitive impairment and 57 AD dementia) individuals, who participated in an ongoing prospective cohort study, were included. All participants underwent comprehensive clinical and neuropsychological assessment, …ABI measurement, apolipoprotein E (APOE ) ɛ4 genotyping, and multi-modal brain imaging including [11 C] Pittsburgh Compound B (PiB)-positron emission tomography (PET) and [18 F] fludeoxyglucose (FDG)-PET, and MRI. Results: General linear model analysis showed significant relationship between ABI strata (low ABI: <1.00, normal ABI: 1.00–1.29, and high ABI: ≥1.30) and AD-signature region cerebral glucose metabolism (AD-CM), even after controlling age, sex, clinical dementia rating–sum of box, and APOE ɛ4 positivity (p  = 0.029). Post hoc comparison revealed that low ABI had significantly lower AD-CM than middle and high ABI, while no difference of AD-CM was found between middle and high ABI. There was no significant difference of global Aβ deposition, AD-signature region cortical thickness, and white matter hyperintensity volume between the three ABI strata. Conclusion: Our findings suggest that lower ABI, likely related to atherosclerosis, may contribute to the aggravation of AD-related regional neurodegeneration in cognitively impaired older adults. Show more

Keywords: Alzheimer’s disease, ankle-brachial index, cerebral Aβ deposition, mild cognitive impairment, neurodegeneration

DOI: 10.3233/JAD-220911

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 87-95, 2023

Authors: Schuurmans, Isabel K. | Hoepel, Sanne J.W. | Cecil, Charlotte A.M. | Hillegers, Manon H.J. | Ikram, M. Arfan | Luik, Annemarie I.

Article Type: Research Article

Abstract: Background: Cognitive and brain reserve refer to individual differences that allow some people to better withstand brain pathology than others. Although early life stress has been recognized as a risk factor for low reserve in late life, no research yet has studied this across midlife. Objective: To examine the associations of life stress with brain and cognitive reserve in midlife. Methods: We included 1,232 middle-aged women who participated in the ORACLE Study between 2002-2006). Life stress was calculated as the shared variance of four cumulative stress domains, created from items measured between pregnancy and 10 years …after childbirth. Brain reserve was defined as healthy-appearing brain volume measured with MRI; cognitive reserve as better cognitive functioning than expected based on age, education, and brain MRI measures, using structural equation modelling. Results: More life stress was associated with lower brain (standardized adjusted difference: -0.18 [95% CI 0.25,-0.12]) and cognitive reserve (-0.19 [-0.28,-0.10]). Although, effect sizes were typically smaller, cumulative stress domains were also associated with brain reserve (life events: -0.10 [-0.16,-0.04]; contextual stress: -0.13 [-0.19,-0.07]; parenting-related stress: -0.13[-0.19,-0.07]; interpersonal stress: -0.10 [-0.16,-0.04]) and cognitive reserve (life events: -0.18 [-0.25,-0.11]; contextual stress: -0.15 [-0.10,-0.02]; parenting-related stress: -0.10 [-0.18,-0.03]; interpersonal stress not significant). Conclusion: Women who experience more life stress in midlife were found to have lower reserve. Effects were primarily driven by shared variance across cumulative stress domains, suggesting that focusing on single domains may underestimate effects. The effect of life stress on lower reserve may make women with stress more prone to neurodegenerative disease later in life than women without stress. Show more

Keywords: Cognitive reserve, epidemiology, middle aged, psychological, stress

DOI: 10.3233/JAD-220923

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 97-106, 2023

Authors: Krebs, Christine | Brill, Esther | Minkova, Lora | Federspiel, Andrea | Kellner-Weldon, Frauke | Wyss, Patric | Teunissen, Charlotte E. | van Harten, Argonde C. | Seydell-Greenwald, Anna | Klink, Katharina | Züst, Marc A. | Brem, Anna-Katharine | Klöppel, Stefan

Article Type: Research Article

Abstract: Background: Preclinical Alzheimer’s disease (AD) is one possible cause of subjective cognitive decline (SCD). Normal task performance despite ongoing neurodegeneration is typically considered as neuronal compensation, which is reflected by greater neuronal activity. Compensatory brain activity has been observed in frontal as well as parietal regions in SCD, but data are scarce, especially outside the memory domain. Objective: To investigate potential compensatory activity in SCD. Such compensatory activity is particularly expected in participants where blood-based biomarkers indicated amyloid positivity as this implies preclinical AD. Methods: 52 participants with SCD (mean age: 71.00±5.70) underwent structural and functional …neuroimaging (fMRI), targeting episodic memory and spatial abilities, and a neuropsychological assessment. The estimation of amyloid positivity was based on plasma amyloid-β and phosphorylated tau (pTau181) measures. Results: Our fMRI analyses of the spatial abilities task did not indicate compensation, with only three voxels exceeding an uncorrected threshold at p  < 0.001. This finding was not replicated in a subset of 23 biomarker positive individuals. Conclusion: Our results do not provide conclusive evidence for compensatory brain activity in SCD. It is possible that neuronal compensation does not manifest at such an early stage as SCD. Alternatively, it is possible that our sample size was too small or that compensatory activity may be too heterogeneous to be detected by group-level statistics. Interventions based on the individual fMRI signal should therefore be explored. Show more

Keywords: Blood-based biomarkers, functional MRI, neuronal compensation, episodic memory, spatial abilities, subjective cognitive decline

DOI: 10.3233/JAD-221001

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 107-124, 2023

Authors: Dolcet-Negre, Marta M. | Imaz Aguayo, Laura | García-de-Eulate, Reyes | Martí-Andrés, Gloria | Fernández-Matarrubia, Marta | Domínguez, Pablo | Fernández-Seara, Maria A. | Riverol, Mario

Article Type: Research Article

Abstract: Background: Subjective cognitive decline (SCD) may represent a preclinical stage of Alzheimer’s disease (AD). Predicting progression of SCD patients is of great importance in AD-related research but remains a challenge. Objective: To develop and implement an ensemble machine learning (ML) algorithm to identify SCD subjects at risk of conversion to mild cognitive impairment (MCI) or AD. Methods: Ninety-nine SCD patients were included. Thirty-two progressed to MCI/AD, while 67 remained stable. To minimize the effect of class imbalance, both classes were balanced, and sensitivity was taken as evaluation metric. Bagging and boosting ML models were developed by …using socio-demographic and clinical information, Mini-Mental State Examination and Geriatric Depression Scale (GDS) scores (feature-set 1a); socio-demographic characteristics and neuropsychological tests scores (feature-set 1b) and regional magnetic resonance imaging grey matter volumes (feature-set 2). The most relevant variables were combined to find the best model. Results: Good prediction performances were obtained with feature-sets 1a and 2. The most relevant variables (variable importance exceeding 20%) were: Age, GDS, and grey matter volumes measured in four cortical regions of interests. Their combination provided the optimal classification performance (highest sensitivity and specificity) ensemble ML model, Extreme Gradient Boosting with over-sampling of the minority class, with performance metrics: sensitivity = 1.00, specificity = 0.92 and area-under-the-curve = 0.96. The median values based on fifty random train/test splits were sensitivity = 0.83 (interquartile range (IQR) = 0.17), specificity = 0.77 (IQR = 0.23) and area-under-the-curve = 0.75 (IQR = 0.11). Conclusion: A high-performance algorithm that could be translatable into practice was able to predict SCD conversion to MCI/AD by using only six predictive variables. Show more

Keywords: Alzheimer’s disease, classification, machine learning, mild cognitive impairment, subjective cognitive decline

DOI: 10.3233/JAD-221002

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 125-140, 2023

Authors: Brenner, Einat K. | Weigand, Alexandra J. | Edwards, Lauren | Thomas, Kelsey R. | Edmonds, Emily C. | Bondi, Mark W. | Bangen, Katherine J.

Article Type: Research Article

Abstract: Background: Brain-derived neurotrophic factor (BDNF) is a neurotrophin that plays an important role in regulating synaptic activity and plasticity. Objective: Given that type-2 diabetes (T2DM) increases the risk of cognitive decline, and studies have suggested lower BDNF levels may be a risk factor of diabetic neurovascular complications, we sought to investigate total white matter hyperintensities (WMH) as a moderator of the effect of BDNF on hippocampal volume and cognition. Methods: Older adults without dementia from the Alzheimer’s Disease Neuroimaging Initiative (N = 454 including 49 with T2DM and 405 without diabetes) underwent neuropsychological evaluation, magnetic resonance imaging to …quantify hippocampal and WMH volumes, and blood draw to assess BDNF. Results: Adjusting for age, sex, and APOE ɛ4 carrier status, there was a significant interaction between total WMH and BDNF on bilateral hippocampal volume in the non-T2DM group (t  = 2.63, p  = 0.009). Examination of main effect models with a dichotomous high/low BNDF group revealed a significant main effect for low BDNF (t  = –4.98, p  < 0.001), such that as WMH increased, bilateral hippocampal volume decreased. There was also a significant interaction between total WMH and BDNF on processing speed in the non-T2DM group (t  = 2.91, p  = 0.004). There was a significant main effect for low BDNF (t  = –3.55, p  < 0.001) such that as WMH increased, processing speed decreased. The interactions were not significant in the T2DM group. Conclusion: These results further elucidate the protective role that BDNF plays on cognition, as well as the cognitive effects of WMH. Show more

Keywords: Alzheimer’s disease, brain-derived neurotrophic factor, hippocampal volume, neuropsychology, type-2 diabetes, white matter hyperintensities

DOI: 10.3233/JAD-221178

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 141-149, 2023

Authors: Rodrigues Martins, Dina | Vandermeeren, Marc | Van Kolen, Kristof | Brepoels, Eddy | Borgers, Marianne | Wintmolders, Cindy | Delay, Charlotte | Bottelbergs, Astrid | Mercken, Marc | Theunis, Clara

Article Type: Research Article

Abstract: Background: Clearance of tau seeds by immunization with tau antibodies is currently evaluated as therapeutic strategy to block the spreading of tau pathology in Alzheimer’s disease and other tauopathies. Preclinical evaluation of passive immunotherapy is performed in different cellular culture systems and in wild-type and human tau transgenic mouse models. Depending on the preclinical model used, tau seeds or induced aggregates can either be of mouse, human or mixed origin. Objective: We aimed to develop human and mouse tau-specific antibodies to discriminate between the endogenous tau and the introduced form in preclinical models. Methods: Using hybridoma …technology, we developed human and mouse tau-specific antibodies that were then used to develop several assays to specifically detect mouse tau. Results: Four antibodies, mTau3, mTau5, mTau8, and mTau9, with a high degree of specificity for mouse tau were identified. Additionally, their potential application in highly sensitive immunoassays to measure tau in mouse brain homogenate and cerebrospinal fluid is illustrated, as well as their application for specific endogenous mouse tau aggregation detection. Conclusion: The antibodies reported here can be very important tools to better interpret the results obtained from different model systems as well as to study the role of endogenous tau in tau aggregation and pathology observed in the diverse mouse models available. Show more

Keywords: Antibodies, assay development, cerebrospinal fluid, murine tau, tau aggregation

DOI: 10.3233/JAD-221266

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 151-167, 2023

Authors: Gao, Yang | Liu, Yanchao | Zhang, Yao | Wang, Yuying | Zheng, Jie | Xu, Zhipeng | Yu, Haitao | Jin, Zetao | Yin, Yin | He, Benrong | Sun, Fei | Xiong, Rui | Lei, Huiyang | Jiang, Tao | Liang, Yi | Ke, Dan | Zhao, Shi | Mo, Wen | Li, Yanni | Zhou, Qiuzhi | Wang, Xin | Zheng, Chenghong | Zhang, Huaqiu | Liu, Gongping | Yang, Ying | Wang, Jian-Zhi

Article Type: Research Article

Abstract: Background: Olfactory dysfunction appears prior to cognitive decline, and thus it has been suggested to be an early predictor of Alzheimer’s disease. However, it is currently not known whether and how olfactory threshold test could serve as a quick screening tool for cognitive impairment. Objective: To define olfactory threshold test for screening cognitive impairment in two independent cohorts. Methods: The participants are comprised of two cohorts in China, 1,139 inpatients with type 2 diabetes mellitus (T2DM, Discovery cohort) and 1,236 community-dwelling elderly (Validation cohort). Olfactory and cognitive functions were evaluated by Connecticut Chemosensory Clinical Research Center …test and Mini-Mental State Examination (MMSE), respectively. Regression analyses and receiver operating characteristic (ROC) analyses were carried out to determine the relation and discriminative performance of the olfactory threshold score (OTS) regarding identification of cognition impairment. Results: Regression analysis showed that olfactory deficit (reducing OTS) was correlated with cognitive impairment (reducing MMSE score) in two cohorts. ROC analysis revealed that the OTS could distinguish cognitive impairment from cognitively normal individuals, with mean area under the curve values of 0.71 (0.67, 0.74) and 0.63 (0.60, 0.66), respectively, but it failed to discriminate dementia from mild cognitive impairment. The cut-off point of 3 showed the highest validity for the screening, with the diagnostic accuracy of 73.3% and 69.5%. Conclusion: Reducing OTS is associated with cognitive impairment in T2DM patients and the community-dwelling elderly. Therefore, olfactory threshold test may be used as a readily accessible screening tool for cognitive impairment. Show more

Keywords: Cut-off value, mild cognitive impairment, olfactory function, type 2 diabetes mellitus

DOI: 10.3233/JAD-230023

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 169-178, 2023

Authors: Turcotte, Valérie | Hudon, Carol | Potvin, Olivier | Dadar, Mahsa | Duchesne, Simon

Article Type: Research Article

Abstract: Background: Slowed rates of cognitive decline have been reported in individuals with higher cognitive reserve (CR), but interindividual discrepancies remain unexplained. Few studies have reported a birth cohort effect, favoring later-born individuals, but these studies remain scarce. Objective: We aimed to predict cognitive decline in older adults using birth cohorts and CR. Methods: Within the Alzheimer’s Disease Neuroimaging Initiative, 1,041 dementia-free participants were assessed on four cognitive domains (verbal episodic memory; language and semantic memory; attention; executive functions) at each follow-up visit up to 14 years. Four birth cohorts were formed according to the major historical …events of the 20th century (1916–1928; 1929–1938; 1939–1945; 1946–1962). CR was operationalized by merging education, complexity of occupation, and verbal IQ. We used linear mixed-effect models to evaluate the effects of CR and birth cohorts on rate of performance change over time. Age at baseline, baseline structural brain health (total brain and total white matter hyperintensities volumes), and baseline vascular risk factors burden were used as covariates. Results: CR was only associated with slower decline in verbal episodic memory. However, more recent birth cohorts predicted slower annual cognitive decline in all domains, except for executive functions. This effect increased as the birth cohort became more recent. Conclusion: We found that both CR and birth cohorts influence future cognitive decline, which has strong public policy implications. Show more

Keywords: Aging, birth cohorts, cognitive decline, cognitive reserve, generations, neuropsychology

DOI: 10.3233/JAD-220951

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 179-191, 2023

Authors: Franz, Carol E. | Gustavson, Daniel E. | Elman, Jeremy A. | Fennema-Notestine, Christine | Hagler Jr., Donald J. | Baraff, Aaron | Tu, Xin M. | Wu, Tsung-Chin | De Anda, Jaden | Beck, Asad | Kaufman, Joel D. | Whitsel, Nathan | Finch, Caleb E. | Chen, Jiu-Chiuan | Lyons, Michael J. | Kremen, William S.

Article Type: Research Article

Abstract: Background: Fine particulate matter (PM2.5 ) and nitrogen dioxide (NO2 ) measures of ambient air pollution are associated with accelerated age-related cognitive impairment, and Alzheimer’s disease and related dementias (ADRD). Objective: We examined associations between air pollution, four cognitive factors, and the moderating role of apolipoprotein E (APOE) genotype in the understudied period of midlife. Methods: Participants were ∼1,100 men in the Vietnam Era Twin Study of Aging. Baseline cognitive assessments were from 2003 to 2007. Measures included past (1993–1999) and recent (3 years prior to baseline assessment) PM2.5 and NO2 exposure, in-person …assessment of episodic memory, executive function, verbal fluency, and processing speed, and APOE genotype. Average baseline age was 56 years with a 12-year follow-up. Analyses adjusted for health and lifestyle covariates. Results: Performance in all cognitive domains declined from age 56 to 68. Higher PM2.5 exposures were associated with worse general verbal fluency. We found significant exposure-by-APOE genotype interactions for specific cognitive domains: PM2.5 with executive function and NO2 with episodic memory. Higher PM2.5 exposure was related to worse executive function in APOE ɛ4 carriers, but not in non-carriers. There were no associations with processing speed. Conclusion: These results indicate negative effects of ambient air pollution exposure on fluency alongside intriguing differential modifications of cognitive performance by APOE genotype. APOE ɛ4 carriers appeared more sensitive to environmental differences. The process by which air pollution and its interaction with genetic risk for ADRD affects risk for later life cognitive decline or progression to dementia may begin in midlife. Show more

Keywords: Aging, air pollution, APOE genotype, cognition, midlife, nitrogen dioxide, PM2.5

DOI: 10.3233/JAD-221054

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 193-209, 2023

Authors: Lanooij, Suzanne D. | Eisel, Ulrich L.M. | van der Zee, Eddy A. | Kas, Martien J.H.

Article Type: Research Article

Abstract: Background: Altered social behavior is one of the symptoms of Alzheimer’s disease (AD) that results in social withdrawal and loneliness and provides a major burden on patients and their relatives. Furthermore, loneliness is associated with an increased risk to develop AD and related dementias. Objective: We aimed to investigate if altered social behavior is an early indicator of amyloid-β (Aβ) pathology in J20 mice, and if co-housing with wild type (WT) mice can positively influence this social phenotype. Methods: The social phenotype of group-housed mice was assessed using an automated behavioral scoring system for longitudinal recordings. …Female mice were housed in a same-genotype (4 J20 or WT mice per colony) or mixed-genotype (2 J20 mice + 2 WT mice) colony. At 10 weeks of age, their behavior was assessed for five consecutive days. Results: J20 mice showed increased locomotor activity and social sniffing, and reduced social contact compared to WT mice housed in same-genotype colonies. Mixed-genotype housing reduced the social sniffing duration of J20 mice, increased social contact frequency of J20 mice, and increased nest hide by WT mice. Conclusion: Thus, altered social behavior can be used as an early indicator of Aβ-pathology in female J20 mice. Additionally, when co-housed with WT mice, their social sniffing phenotype is not expressed and their social contact phenotype is reduced. Our findings highlight the presence of a social phenotype in the early stages of AD and indicate a role for social environment variation in the expression of social behavior of WT and J20 mice. Show more

Keywords: Alzheimer’s disease, amyloid, gene-environment interaction, mice, social behavior, social environment

DOI: 10.3233/JAD-221126

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 211-224, 2023

Authors: Chu, Min | Nan, Haitian | Jiang, Deming | Liu, Li | Huang, Anqi | Wang, Yihao | Wu, Liyong

Article Type: Research Article

Abstract: Background: Progranulin (GRN ) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. Objective: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. Methods: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. Results: Neuroimaging revealed marked lateral atrophy and hypometabolism …in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient’s genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients – mostly female – with GRN mutations; the prevalence was 1.2% –2.6% and patients mostly had early disease onset. Conclusion: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD. Show more

Keywords: China, frontotemporal dementia, genetics, Progranulin (GRN)

DOI: 10.3233/JAD-230052

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 225-234, 2023

Authors: Ziyad, Shabana R. | Alharbi, Meshal | Altulyan, May

Article Type: Research Article

Abstract: Background: Alzheimer’s disease (AD) is a neurodegenerative disease that drastically affects brain cells. Early detection of this disease can reduce the brain cell damage rate and improve the prognosis of the patient to a great extent. The patients affected with AD tend to depend on their children and relatives for their daily chores. Objective: This research study utilizes the latest technologies of artificial intelligence and computation power to aid the medical industry. The study aims at early detection of AD to enable doctors to treat patients with the appropriate medication in the early stages of the …disease condition. Methods: In this research study, convolutional neural networks, an advanced deep learning technique, are adopted to classify AD patients with their MRI images. Deep learning models with customized architecture are precise in the early detection of diseases with images retrieved by neuroimaging techniques. Results: The convolution neural network model classifies the patients as diagnosed with AD or cognitively normal. Standard metrics evaluate the model performance to compare with the state-of-the-art methodologies. The experimental study of the proposed model shows promising results with an accuracy of 97%, precision of 94%, recall rate of 94%, and f1-score of 94%. Conclusion: This study leverages powerful technologies like deep learning to aid medical practitioners in diagnosing AD. It is crucial to detect AD early to control and slow down the rate at which the disease progresses. Show more

Keywords: Alzheimer’s disease, artificial intelligence system, cognitive normal, convolution neural network

DOI: 10.3233/JAD-221250

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 235-245, 2023

Authors: Parka, Aleksandra | Volbracht, Christiane | Hall, Benjamin | Bastlund, Jesper F. | Nedergaard, Maiken | Laursen, Bettina | Botta, Paolo | Sotty, Florence

Article Type: Research Article

Abstract: Background: Tauopathies such as Alzheimer’s disease (AD) and frontotemporal dementia (FTD) are characterized by formation of neurofibrillary tangles consisting of hyperphosphorylated tau protein. Early pathophysiological and functional changes related to neurofibrillary tangles formation are considered to occur prior to extensive neurodegeneration. Hyperphosphorylated tau has been detected in postmortem retinas of AD and FTD patients, and the visual pathway is an easily accessible system in a clinical setting. Hence, assessment of the visual function may offer the potential to detect consequences of early tau pathology in patients. Objective: The aim of this study was to evaluate visual function in …a tauopathy mouse model in relation to tau hyperphosphorylation and neurodegeneration. Methods: In this study we explored the association between the visual system and functional consequences of tau pathology progression using a tauopathy rTg4510 mouse model. To this end, we recorded full-field electroretinography and visual evoked potentials in anesthetized and awake states at different ages. Results: While retinal function remained mostly intact within all the age groups investigated, we detected significant changes in amplitudes of visual evoked potential responses in young rTg4510 mice exhibiting early tau pathology prior to neurodegeneration. These functional alterations in the visual cortex were positively correlated with pathological tau levels. Conclusion: Our findings suggest that visual processing could be useful as a novel electrophysiological biomarker for early stages of tauopathy. Show more

Keywords: Alzheimer’s disease, electroretinography, frontotemporal dementia, rTg4510, tauopathies, visual evoked potentials

DOI: 10.3233/JAD-220964

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 247-262, 2023

Authors: Rahmani, Farzaneh | Ghezzi, Laura | Tosti, Valeria | Liu, Jingxia | Song, Sheng-Kwei | Wu, Anthony T. | Rajamanickam, Jayashree | Obert, Kathleen A. | Benzinger, Tammie L.S. | Mittendorfer, Bettina | Piccio, Laura | Raji, Cyrus A.

Article Type: Research Article

Abstract: Background: Multiple sclerosis (MS) is a prototype neuroinflammatory disorder with increasingly recognized role for neurodegeneration. Most first-line treatments cannot prevent the progression of neurodegeneration and the resultant disability. Interventions can improve symptoms of MS and might provide insights into the underlying pathology. Objective: To investigate the effect of intermittent caloric restriction on neuroimaging markers of MS. Methods: We randomized ten participants with relapsing remitting MS to either a 12-week intermittent calorie restriction (iCR) diet (n  = 5) or control (n  = 5). Cortical thickness and volumes were measured through FreeSurfer, cortical perfusion was measured by arterial spin labeling …and neuroinflammation through diffusion basis spectrum imaging. Results: After 12 weeks of iCR, brain volume increased in the left superior and inferior parietal gyri (p: 0.050 and 0.049, respectively) and the banks of the superior temporal sulcus (p: 0.01). Similarly in the iCR group, cortical thickness improved in the bilateral medial orbitofrontal gyri (p: 0.04 and 0.05 in right and left, respectively), the left superior temporal gyrus (p: 0.03), and the frontal pole (p: 0.008) among others. Cerebral perfusion decreased in the bilateral fusiform gyri (p: 0.047 and 0.02 in right and left, respectively) and increased in the bilateral deep anterior white matter (p: 0.03 and 0.013 in right and left, respectively). Neuroinflammation, demonstrated through hindered and restricted water fractions (HF and RF), decreased in the left optic tract (HF p: 0.02), and the right extreme capsule (RF p: 0.007 and HF p: 0.003). Conclusion: These pilot data suggest therapeutic effects of iCR in improving cortical volume and thickness and mitigating neuroinflammation in midlife adults with MS. Show more

Keywords: Alzheimer’s disease, arterial spin labeling, caloric restriction, diffusion basis spectrum imaging, multiple sclerosis, neuroinflammation, prevention, relative cerebral blood flow

DOI: 10.3233/JAD-221007

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 263-273, 2023

Authors: Fortea, Juan | García-Arcelay, Elena | Terrancle, Ángeles | Gálvez, Blanca | Díez-Carreras, Verónica | Rebollo, Pablo | Maurino, Jorge | Garcia-Ribas, Guillermo

Article Type: Research Article

Abstract: Background: Alzheimer’s disease (AD) biomarkers reflect key elements of pathophysiology and improve the diagnostic process. However, their use in routine clinical practice is still limited. Objective: We aimed to assess neurologists' barriers and enablers to early AD diagnosis using core AD biomarkers. Methods: We conducted an online study in collaboration with the Spanish Society of Neurology. Neurologists answered a survey exploring their attitudes towards AD diagnosis using biomarkers in mild cognitive impairment (MCI) or mild AD dementia. Multivariate logistic regression analyses were conducted to determine the association between neurologists’ characteristics and diagnostic attitudes. Results: …We included 188 neurologists with a mean age (SD) of 40.6 (11.3) years, 52.7% male. Most participants had access to AD biomarkers, mainly in cerebrospinal fluid (CSF) (89.9%,#x0025;, n  = 169). The majority of participants (95.2%,#x0025;, n  = 179) considered CSF biomarkers useful for an etiological diagnosis in MCI. However, 85.6% of respondents (n  = 161) used them in less than 60% of their MCI patients in routine clinical practice. Facilitating patients and their families to plan for the future was the most frequent enabler for the use of biomarkers. Short consultation time and practicalities associated with the programming of a lumbar puncture were the most common barriers. A younger neurologist age (p  = 0.010) and a higher number of patients managed weekly (p  = 0.036) were positively associated with the use of biomarkers. Conclusion: Most neurologists had a favorable attitude to the use of biomarkers, especially in MCI patients. Improvements in resources and consultation time may increase their use in routine clinical practice. Show more

Keywords: Alzheimer’s disease, biomarkers, decision making, diagnosis, neurologists

DOI: 10.3233/JAD-221160

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 275-282, 2023

Authors: Sun, Yan | Hu, He-Ying | Hu, Hao | Huang, Liang-Yu | Tan, Lan | Yu, Jin-Tai

Article Type: Research Article

Abstract: Background: Cerebral small vessel disease (CSVD) has been suggested to contribute to the pathogenesis of Alzheimer’s disease (AD). Objective: This study aimed to comprehensively investigated the associations of CSVD burden with cognition and AD pathologies. Methods: A total of 546 non-demented participants (mean age, 72.1 years, range, 55–89; 47.4% female) were included. The longitudinal neuropathological and clinical correlates of CSVD burden were assessed using linear mixed-effects and Cox proportional-hazard models. Partial least squares structural equation model (PLS-SEM) was used to assess the direct and indirect effects of CSVD burden on cognition. …Results: We found that higher CSVD burden was associated with worse cognition (MMSE, β= –0.239, p  = 0.006; MoCA, β= –0.493, p  = 0.013), lower cerebrospinal fluid (CSF) Aβ level (β= –0.276, p  < 0.001) and increased amyloid burden (β= 0.048, p  = 0.002). In longitudinal, CSVD burden contributed to accelerated rates of hippocampus atrophy, cognitive decline, and higher risk of AD dementia. Furthermore, as the results of PLS-SEM, we observed both significant direct and indirect impact of advanced age (direct, β= –0.206, p  < 0.001; indirect, β= –0.002, p  = 0.043) and CSVD burden (direct, β= –0.096, p  = 0.018; indirect, β= –0.005, p  = 0.040) on cognition by Aβ-p-tau-tau pathway. Conclusion: CSVD burden could be a prodromal predictor for clinical and pathological progression. Simultaneously, we found that the effects were mediated by the one-direction-only sequence of pathological biomarker changes starting with Aβ, through abnormal p-tau, and neurodegeneration. Show more

Keywords: Alzheimer’s disease, cerebral small vessel disease, cerebrospinal fluid biomarkers, cognition, partial least squares structural equation pathway model

DOI: 10.3233/JAD-221207

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 283-294, 2023

Authors: Lv, Xuedan | Chu, Min | Liu, Yang | Jing, Donglai | Liu, Li | Cui, Yue | Wang, Yihao | Jiang, Deming | Song, Weiqun | Yang, Caishui | Wu, Liyong

Article Type: Research Article

Abstract: Background: Research on posterior cortical atrophy (PCA) has focused on cognitive decline, especially visual processing deficits. However, few studies have examined the impact of PCA on activities of daily living (ADL) and the neurofunctional and neuroanatomic bases of ADL. Objective: To identify brain regions associated with ADL in PCA patients. Methods: A total of 29 PCA patients, 35 typical Alzheimer’s disease (tAD) patients, and 26 healthy volunteers were recruited. Each subject completed an ADL questionnaire that included basic and instrumental subscales (BADL and IADL, respectively), and underwent hybrid magnetic resonance imaging and 18 …F fluorodeoxyglucose positron emission tomography. Voxel-wise regression multivariable analysis was conducted to identify specific brain regions associated with ADL. Results: General cognitive status was similar between PCA and tAD patients; however, the former had lower total ADL scores and BADL and IADL scores. All three scores were associated with hypometabolism in bilateral parietal lobes (especially bilateral superior parietal gyri) at the whole-brain level, PCA-related hypometabolism level, and PCA-specific hypometabolism level. A cluster that included the right superior parietal gyrus showed an ADL×group interaction effect that was correlated with the total ADL score in the PCA group (r  = –0.6908, p  = 9.3599e–5 ) but not in the tAD group (r  = 0.1006, p  = 0.5904). There was no significant association between gray matter density and ADL scores. Conclusion: Hypometabolism in bilateral superior parietal lobes contributes to a decline in ADL in patients with PCA and can potentially be targeted by noninvasive neuromodulatory interventions. Show more

Keywords: Alzheimer’s disease, posterior cortical atrophy, activities of daily living, FDG-PET, neuroimaging

DOI: 10.3233/JAD-221229

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 295-305, 2023

Authors: Jang, Sehwan | Chorna, Nataliya | Rodríguez-Graciani, Keishla M. | Inyushin, Mikhail | Fossati, Silvia | Javadov, Sabzali

Article Type: Research Article

Abstract: Background: An increasing number of experimental and clinical studies show a link between Alzheimer’s disease and heart diseases such as heart failure, ischemic heart disease, and atrial fibrillation. However, the mechanisms underlying the potential role of amyloid-β (Aβ) in the pathogenesis of cardiac dysfunction in Alzheimer’s disease remain unknown. We have recently shown the effects of Aβ1 - 40 and Aβ1 - 42 on cell viability and mitochondrial function in cardiomyocytes and coronary artery endothelial cells. Objective: In this study, we investigated the effects of Aβ1 - 40 and Aβ1 - 42 on the metabolism of cardiomyocytes and coronary artery …endothelial cells. Methods: Gas chromatography-mass spectrometry was used to analyze metabolomic profiles of cardiomyocytes and coronary artery endothelial cells treated with Aβ1 - 40 and Aβ1 - 42 . In addition, we determined mitochondrial respiration and lipid peroxidation in these cells. Results: We found that the metabolism of different amino acids was affected by Aβ1 - 42 in each cell type, whereas the fatty acid metabolism is consistently disrupted in both types of cells. Lipid peroxidation was significantly increased, whereas mitochondrial respiration was reduced in both cell types in response to Aβ1 - 42 . Conclusion: This study revealed the disruptive effects of Aβ on lipid metabolism and mitochondria function in cardiac cells. Show more

Keywords: Alzheimer’s disease, amyloid-β , cardiomyocytes, coronary artery endothelial cells, metabolomics, mitochondria

DOI: 10.3233/JAD-221199

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 307-319, 2023

Authors: El-Hayeck, Rita | Wehbé, Amine | Baddoura, Rafic | Khoury, Rita | Bassil, Nazem | Abou Khaled, Karine | Koussa, Salam | Richa, Sami | Alameddine, Abbas | Sellal, François

Article Type: Research Article

Abstract: Background: Verbal fluency tasks are frequently used for neuropsychological assessment in clinical practice and research. It consists of two tasks namely category and letter fluency tests. Objective: To determine normative values in category (animals, vegetables, fruits) and letter fluency [Mim ( ) “M”, Alif ( ) “A”, Baa ( ) “B”] tasks in Arabic language in 60 s. Methods: This study was a cross-sectional national survey and included 859 community-dwelling, cognitively intact Lebanese residents aged ≥55 years. Norms were presented according to age (55–64 years, 65–74 years, ≥75 years), sex and level of education (illiterate, no diploma, …primary certificate, baccalaureate or higher). Results: Level of education had the most significant positive effect on verbal fluency tasks performance amongst Lebanese older adults. The negative effect of older age was more prominent in the category fluency task compared to the letter fluency task. Women outperformed men in vegetables and fruits categories. Conclusion: This study provides clinicians with normative scores of category and letter fluency tests, which can be used for neuropsychological assessment of older Lebanese patients being evaluated for cognitive disorders. Show more

Keywords: Cognitive aging, dementia, language tests, Lebanon, neuropsychological tests, reference standards

DOI: 10.3233/JAD-221121

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 321-332, 2023

Authors: Nakamura, Takumi | Kawarabayashi, Takeshi | Ueda, Tetsuya | Shimomura, Sachiko | Hoshino, Masaki | Itoh, Ken | Ihara, Kazushige | Nakaji, Shigeyuki | Takatama, Masamitsu | Ikeda, Yoshio | Shoji, Mikio

Article Type: Research Article

Abstract: Background: APOE4 is the strongest risk factor for Alzheimer’s disease (AD). However, limited information is currently available on APOE4 and the pathological role of plasma apolipoprotein E (ApoE) 4 remains unclear. Objective: The aims of the present study were to measure plasma levels of total ApoE (tE), ApoE2, ApoE3, and ApoE4 using mass spectrometry and elucidate the relationships between plasma ApoE and blood test items. Methods: We herein examined plasma levels of tE, ApoE2, ApoE3, and ApoE4 in 498 subjects using liquid chromatograph-mass spectrometry (LC-MS/MS). Results: Among 498 subjects, mean age was …60 years and 309 were female. tE levels were distributed as ApoE2/E3 = ApoE2/E4 >ApoE3/E3 = ApoE3/E4 >ApoE4/E4. In the heterozygous group, ApoE isoform levels were distributed as ApoE2 >ApoE3 >ApoE4. ApoE levels were not associated with aging, the plasma amyloid-β (Aβ) 40/42 ratio, or the clinical diagnosis of AD. Total cholesterol levels correlated with the level of each ApoE isoform. ApoE2 levels were associated with renal function, ApoE3 levels with low-density lipoprotein cholesterol and liver function, and ApoE4 levels with triglycerides, high-density lipoprotein cholesterol, body weight, erythropoiesis, and insulin metabolism. Conclusion: The present results suggest the potential of LC-MS/MS for the phenotyping and quantitation of plasma ApoE. Plasma ApoE levels are regulated in the order of ApoE2 >ApoE3 >ApoE4 and are associated with lipids and multiple metabolic pathways, but not directly with aging or AD biomarkers. The present results provide insights into the multiple pathways by which peripheral ApoE4 influences the progression of AD and atherosclerosis. Show more

Keywords: Alzheimer’s disease, amyloid-β , ApoE, biomarkers, cholesterol, HDL, isoform, LDL

DOI: 10.3233/JAD-220996

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 333-348, 2023

Authors: Widjaya, Michael Anekson | Cheng, Yu-Jung | Kuo, Yu-Min | Liu, Chia-Hsin | Cheng, Wei-Chung | Lee, Shin-Da

Article Type: Research Article

Abstract: Background: Research reported exercise could reduce Alzheimer’s disease (AD) symptoms in human and animals. However, the molecular mechanism of exercise training via transcriptomic analysis was unclear especially in AD in the cortex area. Objective: Investigate potential significant pathways in the cortex area that were affected by exercise during AD. Methods: RNA-seq analysis, differential expressed genes, functional enrichment analysis, and GSOAP clustering analysis were performed in the isolated cerebral cortex from eight 3xTg AD mice (12 weeks old) randomly and equally divided into control (AD) and exercise training (AD-EX) group. Swimming exercise training in AD-EX group was …conducted 30 min/day for 1 month. Results: There were 412 genes significant differentially expressed in AD-EX group compared to AD group. Top 10 upregulated genes in AD-EX group against AD group mostly correlated with neuroinflammation, while top 10 downregulated genes mostly had connection with vascularization, membrane transport, learning memory, and chemokine signal. Pathway analysis revealed the upregulated interferon alpha beta signaling in AD-EX had association with cytokines delivery in microglia cells compared to AD and top 10 upregulated genes involved in interferon alpha beta were Usp18 , Isg15 , Mx1 , Mx2 , Stat1 , Oas1a , and Irf9 ; The downregulated extracellular matrix organization in AD-EX had correlation with Aβ and neuron cells interaction and Vtn was one of the top 10 downregulated genes involved in this pathway. Conclusion: Exercise training influenced 3xTg mice cortex through interferon alpha beta signaling upregulation and extracellular matrix organization downregulation based on transcriptomics analysis. Show more

Keywords: Alzheimer’s disease, bioinformatics, cortex, exercise

DOI: 10.3233/JAD-221139

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 349-363, 2023

Authors: Tetlow, Amber M. | Jackman, Brianna M. | Alhadidy, Mohammed M. | Perumal, Varshini | Morgan, David G. | Gordon, Marcia N.

Article Type: Research Article

Abstract: Background: Advanced age is the greatest risk factor for the development of Alzheimer’s disease (AD). This implies that some aspect of the aged milieu is possibly accelerating the development of AD related pathologies. Objective: We hypothesized that intracranially injected with AAV9 tauP301L may cause a greater degree of pathology in old versus young mice. Methods: Animals were injected with viral vectors overexpressing the mutant tauP301L or control protein (green fluorescent protein, GFP) into the brains of mature, middle-aged, and old C57BL/6Nia mice. The tauopathy phenotype was monitored four months after injection using behavioral, histological, …and neurochemical measures. Results: Phosphorylated-tau immunostaining (AT8) or Gallyas staining of aggregated tau increased with age, but other measures of tau accumulation were not significantly affected. Overall, AAV-tau injected mice had impaired radial arm water maze performance, increased microglial activation, and showed evidence of hippocampal atrophy. Aging impaired open field and rotarod performance in both AAV-tau and control mice. The efficiency of viral transduction and gene expression were the same at all animal ages. Conclusion: We conclude that tauP301L over expression results in a tauopathy phenotype with memory impairment and accumulation of aggregated tau. However, the effects of aging on this phenotype are modest and not detected by some markers of tau accumulation, similar to prior work on this topic. Thus, although age does influence the development of tauopathy, it is likely that other factors, such as ability to compensate for tau pathology, are more responsible for the increased risk of AD with advanced age. Show more

Keywords: Adeno-associated virus, aging, animal disease models, tauopathy

DOI: 10.3233/JAD-221276

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 365-378, 2023

Authors: Sakurai, Keita | Kaneda, Daita | Morimoto, Satoru | Uchida, Yuto | Inui, Shohei | Kimura, Yasuyuki | Kan, Hirohito | Kato, Takashi | Ito, Kengo | Hashizume, Yoshio

Article Type: Research Article

Abstract: Background: Due to clinicoradiological similarities, including amnestic cognitive impairment and limbic atrophy, differentiation of argyrophilic grain disease (AGD) from Alzheimer’s disease (AD) is often challenging. Minimally invasive biomarkers, especially magnetic resonance imaging (MRI), are valuable in routine clinical practice. Although it is necessary to explore radiological clues, morphometry analyses using new automated analytical methods, including whole-brain voxel-based morphometry (VBM) and surface-based morphometry (SBM), have not been sufficiently investigated in patients with pathologically confirmed AGD and AD. Objective: This study aimed to determine the volumetric differences in VBM and SBM analyses between patients with pathologically confirmed AGD and AD. …Methods: Eight patients with pathologically confirmed AGD with a lower Braak neurofibrillary tangle stage (<III), 11 patients with pathologically confirmed AD without comorbid AGD, and 10 healthy controls (HC) were investigated. Gray matter volumetric changes in VBM and cortical thickness changes in SBM were compared between the two patient groups (i.e., AGD and AD) and the HC group. Results: In contrast to widespread gray matter volume or cortical thickness loss in the bilateral limbic, temporoparietal, and frontal lobes of the AD group, these were limited, especially in the limbic lobes, in the AGD group, compared with that of the HC group. Although bilateral posterior dominant gray matter volume loss was identified in the AD group compared with the AGD group on VBM, there was no significant cluster between these patient groups on SBM. Conclusion: VBM and SBM analyses both showed a different distribution of atrophic changes between AGD and AD. Show more

Keywords: Alzheimer’s disease, argyrophilic grain disease, computational anatomy toolbox 12, statistical parametric mapping, surface-based morphometry, voxel-based morphometry

DOI: 10.3233/JAD-230068

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 379-387, 2023

Authors: Kawakatsu, Shinobu | Kobayashi, Ryota

Article Type: Article Commentary

Abstract: In this issue, Sakurai et al. report on relevant findings for the clinical diagnosis of argyrophilic grain disease (AGD). Their study describes a characteristic atrophy distribution restricted to the limbic lobes, namely the ambient gyrus, in AGD versus Alzheimer’s disease (AD), in pathologically confirmed patients using magnetic resonance imaging by voxel- and surface-based morphometry. Here, we discuss the possibility of employing functional or molecular brain imaging to further improvement of diagnosis of AGD. Additional research is required to elucidate the contributions of comorbid AD and transactive response DNA-binding protein 43 kDa pathologies in patients with AGD.

Keywords: Alzheimer’s disease, argyrophilic grain disease, MRI, SPECT, suspected non-Alzheimer’s disease pathophysiology, tau PET, TDP-43

DOI: 10.3233/JAD-230247

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 389-392, 2023

Article Type: Retraction

DOI: 10.3233/JAD-239002

Citation: Journal of Alzheimer's Disease, vol. 93, no. 1, pp. 393-393, 2023